A+ A A-

Quantification of Ceratitis capitata gut bacterial community in relation to host fruit and its influence on nutritional reserves and the activity of digestive enzymes

Attachments:
Download this file (JNS_SLM_11_3.pdf)Volume 11, Article 03[Volume 11, Article 03]676 kB

Quantification de la charge microbienne intestinale de la Cératite (Ceratitis capitata) en fonction des fruits hôtes et son influence sur les réserves nutritionnelles et l’activité des enzymes digestives





F. DHAOUADI1

M. MSAAD GUERFALI1*

H. HAMDEN1

S. FADHL1

W. DJOBBI1

CHARAABI K.1



Laboratory of biotechnology and nuclear technologies, LR16CNSTN01, National centre of nuclear sciences and technologies, Technopole Sidi Thabet, Tunis, Tunisia.



Abstract–The Mediterranean fruit fly (medfly) Ceratitis capitata (Wiedemann) (Diptera: Tephritidae), is one of the most devastating pests in the world and specially in the Mediterranean area. Various approaches are applied to control medfly. The use of the sterile insect technique (SIT) has been approved in many countries. SIT is a biocontrol method that requires the release of competitive medfly sterile males against wild ones to compete for wild females. Several studies have focused on improving the performance of the released males through the study of their intestinal microbiota. We focused on the quantification of the bacterial community of the intestinal tract in wild Ceratitis derived from several host fruits as well as that of the laboratory strain treated and not treated by irradiation. The total bacterial load in all the wild adults analyzed, does not vary according to the host fruit. On the other hand, it decreases drastically when the pupae have undergone irradiation treatment. Our results did not show any difference between the nutritional reserves in the different sampled wild adults and those of the laboratory. However, we have noticed that the insect adapts very well to the environment in which it evolves. As far as proteolytic activity is concerned, our results showed an important activity on hemoglobin.

Keywords: Medfly, SIT, biocontrol, Microbiota, digestive enzymes, reserves.

Résumé La mouche méditerranéenne des fruits Ceratitis capitata (Wiedemann) (Diptera: Tephritidae) est l’un des ravageurs les plus dévastateurs au monde et plus particulièrement dans la région méditerranéenne. Diverses approches sont appliquées pour contrôler ce ravageur. L'utilisation de la technique des insectes stériles (TIS) a été approuvée dans de nombreux pays. La TIS est une méthode de biocontrôle qui nécessite le lâcher de mâles stériles compétitifs par rapport aux mâles sauvages. Plusieurs études ont porté sur l'amélioration des performances des mâles lâchés grâce à l'étude de leur microbiote intestinal. Nous nous sommes concentrés sur la quantification de la communauté bactérienne du tractus intestinal chez des adultes sauvages dérivées de plusieurs fruits hôtes ainsi que sur ceux de la souche de laboratoire traitée et non traitée par irradiation. La charge bactérienne totale chez tous les adultes sauvages analysés ne varie pas en fonction du fruit hôte. Par contre, elle diminue considérablement lorsque les pupes subissent un traitement par irradiation. Nos résultats n'ont montré aucune différence entre les réserves nutritionnelles des différents adultes sauvages échantillonnés et ceux du laboratoire. Cependant, nous avons remarqué que l'insecte s'adapte très bien à l'environnement dans lequel il évolue. En ce qui concerne l'activité protéolytique, nos résultats ont montré une activité importante sur l'hémoglobine.

Mots clés: Cératite, TIS, biocontrôle, microbiote, enzymes digestives, reserves.

1. Introduction

La mouche méditerranéenne des fruits (Ceratitis capitata ; Diptera:Tephritidae ; Weidemann),encore appelée Cératite, est un ravageur d’importance économique clé pour la production fruitière dans le pourtour du bassin méditerranéen et en Tunisie en particulier. La Cératite est une espèce polyphage qui s'attaque à plus de 570 plantes hôtes (Liquido et al. 2017). Les femelles pratiquent des piqûres de pontes sur les fruits, les asticots après leur éclosion se développent dans la pulpe du fruitet accélèrent son pourrissement et par conséquent sa chute. En Tunisie, sa principale cible est constituée par un grand nombre de cultures fruitières non apparentées, les arbres fruitiers tels que les Citrus, les abricotiers, les pêchers, les néfliers, etc. Elle s’attaque à tous les fruits d’hiver et d’été, causant des dégâts considérables ; ainsi qu’à d’autres espèces telles que le figuier de Barbarie faisant largement partie du contexte tunisien et qui sert d’hôte refuge lorsque qu’il n’y a pas de fruits cultivés disponibles.

Diverses approches sont déployées pour lutter contre la mouche méditerranéenne ; la plus répandue est la lutte chimique. Les traitements chimiques constituent un outil utile pour lutter contre les mouches nuisibles (Ovruskiet Schliserman 2012; Balaure et al. 2017). En Tunisie, les pesticides sont couramment appliqués et cela même pour les pesticides organochlorés interdits par la loi (Bachrouch 2012, Salem 2016). En fait, leur utilisation est sujette à de nombreuses controverses, notamment les substances non sélectives affectant les insectes pollinisateurs et les ennemis naturels des organismes nuisibles. Leur concentration dans l'environnement constitue une menace sérieuse pour la santé des animaux et celle de l'homme (Haddaoui 2015). La résistance développée chez les insectes est un phénomène qui se développe d’une façon inquiétante, l’exemple qui illustre cela parfaitement est la découverte chez une population espagnole sauvage de C. capitata d’une résistance contre le malathion (Magana et al. 2007).

Au cours des dernières années, la Technique de l’Insecte Stérile (TIS) a largement été utilisée pour le contrôle des insectes, c’est une technique différente des méthodes de lutte biologique traditionnelles. La TIS est par définition spécifique à chaque espèce de ravageur, elle repose sur la production en masse de l’espèce cible, sa stérilisation et le lâcher des mâles en plein champs. Les mâles stériles lâchés vont s'accoupler avec les femelles vierges sauvages, ce qui donnera des œufs non viables et la densité de la population sauvage s'effondrera avec le temps (Klassen 2005). La TIS est une méthode biologique de suppression ou d'élimination d'organismes nuisibles respectueuse de l'environnement qui convient très bien à l'approche globale de la gestion intégrée des organismes nuisibles (AW-IPM) (Knipling 1995). Depuis les années soixante-dix, cette technique est largement appliquée contre les populations de C. capitata. Cependant, le succès de la TIS est principalement lié à la performanceet à la compétitivité des mâles lâchés(Dyck et al. 2005). Néanmoins, ces mâles ont subi différents stress dus à la colonisation, l'élevage en masse et l'irradiation.

Plusieurs études se sont intéressées à améliorer la performance des mâles de la Cératite. Ces travaux sont basés sur l’ajout de probiotiques au milieu d’élevage des larves et celui des adultes (Niyazi et al. 2004 ; Hamden et al 2013). Ces études ont été effectuées suite aux différences substantielles trouvées par Ben Ami et al. (2010) entre la composition de la microflore intestinale de la souche sauvage et celle de l’élevage (Vienne 8). En effet, la composition bactérienne au niveau du tractus digestif a une influence sur la longévité et la compétitivité chez les mâles de la Cératite par sa contribution dans le métabolisme du carbone et de l’azote. Cette communauté bactérienne qui est transmise de la mère à sa descendance (essentiellement composée d’entérobactéries) semble être amplifiée par le fruit hôte et maintenue au long du cycle de vie de l’insecte (Behar et al. 2008).

L’objectif de ce travail consiste à quantifier la communauté bactérienne du tractus intestinal chez la Cératite sauvage issue de plusieurs fruits hôtes ainsi que celle du laboratoire traitée et non traitée par irradiation. Les réserves nutritionnelles et les activités de certaines enzymes digestives chez ces adultes ont été analysées afin de déceler une éventuelle relation avec la charge bactérienne digestive.

2. Matériel et Méthodes

2.1. La souche de laboratoire de la Cératite Ceratitis capitata

Les adultes de la mouche méditerranéenne des fruits proviennent d'une colonie de la souche à déterminisme sexuel génétique de la Cératite (GSS) VIENNA 8 (V8) maintenue à l’unité pilote de production des mâles stériles de la Cératite au Centre national de science et de technologie nucléaires (CNSTN) (Msaad Guerfali et al 2007,2011). Cette souche a deux mutations avec deux marqueurs wp et tsl sur les chromosomes Y-autosome 5, produisant des mâles de type sauvage (pupes brunes) et des femelles mutantes (pupes blanches) (Franz 2005). Les mouches adultes ont été nourries de sucre: levure (3: 1) et d’eau. Le régime alimentaire des larves était basé sur la formulation proposée à l'origine par Tanaka et al. (Tanaka 1969) Elle contenait du son de blé comme substrat (28%), de la levure torula comme source de protéines (7%), du sucre comme phagostimulant et une source de glucides (14%) et de l'eau (50%). Toutes les expériences ont été effectuées dans les conditions de laboratoire (23 ° C ± 1 ° C et 60% HR).

2.2. La souche sauvage de la Cératite

Plusieurs fruits hôtes de la Cératite ont été collectés et mis en incubation. Les adultes sont récupérés, une notation a été assignée à chaque adulte émergeant d’un fruit particulier. La notation (AO) pour les adultes issus d’oranges, (AN) pour ceux issus de nèfles, (AB) des bigaradiers) et (AP) pour ceux issus des poires infestées.

2.3. La souche bactérienne

La souche bactérienne utilisée pour quantifier la charge bactérienne intestinale est celle de Klebtiella oxytoca isolée à partir du tractus digestif de la Cératite sauvage et identifiée au laboratoire.

2.4. Dissection des adultes de la Cératite sauvage 

Des adultes de la Cératite fraichement émergés ont été plongés dans une solution de savon, puis rapidement dans de l’éthanol à 70% pour la désinfection, et lavés dans du tampon salin phosphate stérile (PBS). Leurs intestins ont été extraits de manière stérile par dissection sous microscope et conservés dans 50 µl de PBS.

2.5. Quantification des bactéries du tube digestif par PCR quantitative

L’ADN génomique des intestins de la Cératite a été extrait selon le protocole de Baruffi et al. (1995). La quantification de la charge bactérienne des intestins par qPCR a été réalisée sur de l'ADN génomique en utilisant des amorces universelles pour eubactéries afin d'amplifier des fragments d'ARN ribosomal 16S (ARNr) (Wei et al. 2017) (Tableau1). L'analyse qPCR a été réalisée avec le thermocycleur en temps réel Mini Opticon de Bio-Rad avec la technologie SYBR. Une lecture de fluorescence a été effectuée à la fin de chaque étape d'extension. Trois répétitions ont été effectuées et la spécificité des produits d'amplification a été évaluée par analyse de la courbe de fusion. L'efficacité de la PCR était supérieure à 87% pour toutes les paires d'amorces (Tableau 1). L’amplification est réalisée dans un volume total de 20µl contenant 10µM de super mix (Biorad), 0.25µM de chaque amorce, et 1µl d’ADN. Le cycle contient une étape de dénaturation 2’ à 95°C suivie par 35 cycles comprenant une dénaturation de 45’’ à 95°C, une hybridation de 45’’ à 55°C, une élongation de 45’’ à 72°C. Une élongation finale est programmée pendant 7’ à 72°C.Les concentrations des échantillons expérimentaux ont été calculées à partir de la courbe standard réalisée à partir de souche Klebtiella oxytoca de concentration connue. Une série de dilutions a été réalisée allant de 108, 107, 106, 105 et 104. Les échantillons à tester ont été normalisés par le gène de référence G6PD. Les Ct générés ont été analysés comme indiqué sur [http://www.appliedbiosystems.com].

 

Tableau 1  Amorces utilisées pour la quantification de la charge bactérienne intestinale des adultes de la Cératite

Amorce

Séquence, 5’-3’

Application

16SF

TCCTACGGGAGGCAGCAGT

QPcr pour quantifier le gène 16S rARN des eubactéries

16SR

GGACTACCAGGGTATCTAATCCTGTT

Sens G6PD

CGGACGAGCAGGGCAAAATATG

Gène de référence

Anti-sens G6PD

AGACGGACGGCGGGTAAGG

2.6. Etude des réserves nutritionnelles et dosage enzymatique

2.6.1. Dosage des protéines 

La quantité de protéines obtenues à partir de chaque adulte sauvage de la Cératite issu des différents fruits échantillonnés est analysée par la méthode Bradford (1976) en utilisant le BSA comme standard.Chaque adulte est broyé dans 800µl de PBS et centrifugé à 5200 rpm pendant 4’. Au surnageant on ajoute 200µl du réactif de Bradford, de l’étahnol absolu à 4.7% et de l’acide phosphorique à 85%. La quantité de protéines a été déterminée par absorbance à 595 nm. Ce test est répété trois fois.

2.6.2. Dosage des lipides et des sucres

Le dosage des lipides et des sucres est effectué selon le protocole de Yuval et al. (1998) en utilisant l’huile végétale comme standard pour les lipides et le glucose anhydre comme standard pour le sucre.Chaque adulte est broyé dans 200µl de NaSO4 (2%) auquel on ajoute 1300µl d’une solution Chloroforme/Méthanol (1 :2). Après centrifugation à 7150 rpm pendant 10’ le surnageant est récupéré pour le dosage des lipides et des sucres. Pour le dosage des lipides, l’homogénat est séché à 90°C et additionné de H2SO4 et de vanilline selon le protocole suivi. La lecture des lipides est effectuée à la longueur d’onde 530nm. Par contre on ajoute le réactif de l’Anthrone et du H2SO4 pour le dosage des sucres. La lecture se fait à la longueur d’onde 630nm. Ce test est répété trois fois.

2.6.3. Dosages enzymatiques

L’homogénéisation des intestins (n=50) récupérés après dissection est effectuée dans du Tris HCL (50mM) pH=8. Le surnageant est ensuite récupéré pour le dosage des activités enzymatiques. Chaque test est répété trois fois.

2.6.3.1. Mesure des activités Mono-Di et Poly-saccharidiques

L’activité p-nitrophenol a été mesurée dans un tampon acétate de sodium (0.1M) avec le substrat PNPs et du NaCl chacun 3mM. La réaction est arrêtée par alcalinisation du milieu réactionnel avec de l’acide acétique à 30%. La quantité libérée de p-nitrophenol est mesurée à la longueur d’onde 405nm. L’activité spécifique est mesurée en unité d’enzyme par intestin (UE/Int).

Les activités visant les disaccharides (saucrose et Maltose) et les polysaccharides (Pectine, cellulose et amidon) ont été déterminés par la méthode de Bernfeld (1955) telle que modifiée par Baker et al. (1983). Tous les tests ont été répétés trois fois.

2.6.3.2. Mesure des activités protéolytiques hémoglobinase et azocaseinase

Les activités vis-à-vis de l’Azocaseinase et de l’Hémoglobinase ont été déterminées selon le protocole de Silva et al (2006) en utilisant l’hémoglobine et l’azocaséine comme substrats. Tous les tests ont été répétés trois fois.

2.7. Analyse statistique

Chaque test a été répété trois fois. Un contrôle a été mis en place pour chaque expérience. Toutes les données sont présentées sous forme de moyennes ± SE. Les différences entre les groupes ont été testées à l'aide d'une analyse de variance unidirectionnelle (ANOVA)(Stat graphics Centurion XVI) à l'aide des données précédemment vérifiées pour la normalité. Les différences significatives entre les groupes ont été déterminées par un test de différence la moins significative (LSD) à 95% de CL.

 3. Résultats

3.1. La densité relative de la charge microbienne digestive chez la souche sauvage et la souche de laboratoire irradiée de la Cératite

Les résultats de l’analyse par Pcr quantitative en temps réel de la charge microbienne digestive des adultes issus des différents fruits échantillonnés ainsi que des adultes de la souche de laboratoire irradiée ont montré des différences au niveau du nombre de copies (Ct) du gène cible. Les Ct pour les AO sont de l’ordre de 15.41, pour les AB sont de 16.27, pour les AP 18.22 et pour les nèfles 19.07. En revanche, la souche de laboratoire irradiée a montré un nombre de Ct équivalent à 30.37 alors que pour la souche de laboratoire non irradiée nous avons noté une baisse du nombre de Ct à 16.06 (Fig1).

Après correspondance avec la courbe standard établie à partir de la souche Klebtiella oxytoca les Ct ont été traduits en CFU ce qui correspond à 1,01 109 pour les AP, 1.06 109 pour les AN, 1.41 1010 pour les AO, 7.73 109 pour les AB, 8.96 109 pour V8 et 3.57 105 pour V8irr.

Selon l’étude statistique, il existerait une augmentation significative des Ct chez la souche de laboratoire irradiée par rapport à tous les autres échantillons.

 

 

 

Figure 1. Charge bactérienne du tractus digestif des adultes de la Cératite exprimée en CFU.

AO :Adulte issu d’oranges, AN :adulte issu de nèfles, AB : adulte issu de bigarades, V8 : adulte de la souche du laboratoire « Vienne 8 », V8irr : adulte de la souche du laboratoire irradiée « vienne8 »

 

3.2. Dosage des proteins

Les réserves nutritionnelles en protéines chez les adultes sauvages issus des fruits infestés ne présente aucune différence sign²ificative (F=1.73 ; ddl1=5 ; ddl2=12 ; p=0.2). Ceci est valable également pour la souche à déterminisme sexuel génétique de la Cératite irradiée et non irradiée.En effet les moyennes de la composition en protéines des adultes de la Cératite montre des quantités très proches entre les différents échantillons (Tableau 2).

 

3.3. Dosage des lipides

Le dosage des lipides présents chez les adultes obtenus à partir des différents fruits infestés ne présente aucune différence significative entre elles. En outre, la quantité présente chez la souche du laboratoire irradiée est significativement inférieure (42.62) (F=10.06 ; ddl1=5 ; ddl2=12 ; p<0.01).

3.4. Dosage du sucre Les quantités moyennes de sucre dosées chez les adultes de la Cératite issus des fruits infestés ne semblent pas être différentes. En revanche, ces quantités sont différents par rapport à celles existantes chez la souche sauvage (F=31.41 ; ddl1=5 ; ddl2=12; p<0.01).L’exposition aux rayons gamma quant à elle ne semble avoir aucun effet sur la quantité de sucre présente chez la souche de laboratoire (Tableau 2).

 

Tableau2. Dosage des réserves nutritionnelles en sucres, en lipides et en protéines chez les adultes sauvages issus des différents fruits ainsi que la souche de laboratoire Vienne 8.

 

Echantillons

 

AN

AP

AB

AO

V8

V8irr

Sucre (µg/adulte)

6.06± 0.81a

5.14± 0.38 a

4.39± 0.14 a

4.58± 0.26 a

15.47± 1.8b

12.12±0.18b

Lipide

(µg/adulte)

67.67±1.83 a

56.06±6.18 a

63.33±2.19 a

63.33±2.19 a

42.62±1.28b

64.34±2.1 a

Protéine

(µg/adulte)

57.67±3.23 a

59.84±1.54 a

54.49±4.18 a

54.49±4.58 a

56.82±1.91 a

50.31±7.06 a

Les valeurs représentées sont des moyennes ±ES (n=3), des lettres différentes indiquent une différence significative entre les moyennes. Sucre (F=31.41, ddl1=5, ddl2=12, p<0.0001), Lipide (F=10.6, ddl1=5, ddl2=12, p<0.001, F=1.73, ddl1=1.73, ddl1=5, ddl2=12, p<0.2).

AN :adultes issus de nèfles, AP : adultes issus de poires, AB : adultes issus de bigarades, AO : adultes issus d’oranges, V8 : adultes de la souche de laboratoire Vienne8

 

 

3.5. Dosage des activités glucosidasiques et galactosidasiques

L’analyse de l’activité de l’ α-glucosidase entre les différents adultes collectés montre qu’il n’existe pas de différence significative entre les échantillons (F=2.03; ddl1=5 ; ddl2=12 ; p=0.14). Une légère augmentation de cette activité est notée chez la souche de laboratoire irradiée et non irradiée (Fig. 2).

Il en est de même pour l’activité de la β-glucosidase ne présente aucune différence significative chez les adultes sauvages. En revanche elle augmente significativement chez la souche de laboratoire irradiée (F=40.05; ddl1=5 ; ddl2=12 ;P<0.01)(11.23) (Fig.2).

 

 

 

Figure 2. Activité de l’α-glucosidase et de la β-glucosidase au niveau du tractus digestif des adultes de la Cératite.

 

Pareillement, chez la souche de laboratoire irradiéeune légère augmentation de l’activité de l’α-galactosidaseest notée mais qui reste néanmoins non significative. Cependant, l’activité de la β-galactosidase est significativement augmentée chez cette même souche (F= 6.51 ;ddl1=5 ;ddl2=12 ; p<0.01) (Fig.3).

 

 

 

 

 

Figure 3. Activité de l’α-galactosidase et de la β-galactosidase au niveau du tractus digestif des adultes de la Cératite.

3.6. Dosage de l’activité di-saccharidique

L’analyse de l’activité di-saccharidique sur le sucrose chez les adultes de la Cératite sauvages et ceux de laboratoire ne présente aucune différence significative. Pour le maltose, il y a une différence entre les adultes issus des oranges (AO) par rapport à tous les autres adultes (F= 15.07 ; ddl1=5 ; ddl2=12 ; p<0.01) (Fig.4).

 

Figure 4. Activité di-saccharidique au niveau du tube digestif des adultes de la Cératit

3.7. Dosage de l’activité polysaccharidique

L’étude de l’activité cellulosique au niveau de l’intestin présente une différence significative entre les adultes issus des différents fruits collectés et ceux du laboratoire(F=32.67 ; ddl1=5 ; ddl2=12 ; p<0.01) Cette activité subdivise les adultes en deux groupes ceux issus des nèfles et poires chez qui l’ativité enzymatique est nettement inférieure à celle des adultes issus des oranges et ceux du laboratoire irradiés et non irradiés. En revanche l’activité polysaccharidique sur l’amidon est nettement supérieure chez les adultes issus des oranges (F=6.67 ; ddl1=5 ; ddl2=12 ; p<0.01). Le dosage de l’activité pectinase ne montre aucune différence significative chez les adultes analysés (Fig.5).

 

 

 

Figure 5. Activité polysaccharidique au niveau du tube digestif des adultes de la Cératite

3.8.Dosage de l’activité protéolytique

L’activité protéolytique sur l’azocaséine ne montre pas de différence significative entre les adultes analysés (F=2.07 ; ddl1=5 ;ddl2=12 ; p=0.14). Cependant, la souche de laboratoire que ce soit irradiée ou non présente une importante activité de l’hémoglobinase par rapport à tous les autres adultes (F=15.59 ; ddl1=5 ; ddl2=12 ; p<0.01), celle-ci atteint chez les adultes irradiés 77.33 UE/intestin (Fig.6).

 

 

 

Figure 6. Activité protéolytique au niveau tu tube digestif des adultes de la Cératite.

 

4. Discussion

Nous avons pu quantifier la charge microbienne intestinale chez des adultes issus de fruits hôtes ainsi que ceux de la souche du laboratoire (V8) qui ont subi l’irradiation afin de les rendre stériles pour pouvoir les lâcher en plein champs lors de l’application d’une lutte contre la Cératite par la Technique de l’Insecte Stérile. Nous avons également dosé les réserves nutritionnelles de ces adultes ainsi que l’activité de certaines enzymes au niveau de leur tube digestif.

La charge bactérienne totale chez tous les adultes sauvages analysés ne varie pas selon le fruit hôte. Chez la souche de laboratoire, elle diminue drastiquement lorsque les pupes ont subi un traitement par irradiation. En effet, Ben Ami et al. (2010) qui ont travaillé sur l’étude de la communauté bactérienne intestinale chez la Cératite ont trouvé une réduction importante de la charge bactérienne chez les mâles de la Cératite irradiés. Ils ont aussi pu montrer que cette réduction est accompagnée de modifications de la structure bactérienne intestinale qui se traduit par l’apparition de souches de Pseudomonas sp., absente chez les adultes issus des fruits sauvages. Nous pouvons conclure que la charge bactérienne n’est pas affectée quantitativement par l’origine de la souche ou par son régime alimentaire. Mais cette dernière peut avoir une structure différente selon la nature du fruit et selon le stade de développement. En effet, c’est ce qui a été démontré par Malacrino et al. (2018) qui on trouvé que le microbiote bactérien hébergé chez la mouche méditerranéenne des fruits diffère selon les stades et les espèces de plantes hôtes. Une analyse plus poussée utilisant le métabarcodage par le gène 16S ARNr donnera de plus amples informations sur l’écologie globale de la communauté bactérienne de la souche sauvage tunisienne selon les fruits et stades de développement.

Il semble donc évident que la composition du milieu dans lequel évolue la larve et la disponibilité des nutriments va influencer la composition de la charge bactérienne qui a son tour va être déterminante pour le stockage des réserves en carbohydrates et en protéines nécessaires à la longévité et performance des mâles de la Cératite en plein champs (Ben Yosef et al. 2008).

Nos résultats n’ont pas montré de différence entre les réserves nutritionnelles chez les différents adultes échantillonnés et ceux du laboratoire. Par contre, nous avons constaté que l’insecte s’adapte très bien au milieu dans lequel il évolue et exprime une activité carboxylique selon le sucre présent, comme il est le cas chez les (AP) qui présenteraient une forte activité pectinolytique etune activité cellulosique plus importante chez la souche de laboratoire. Ceci est en contradiction avec les résultats de Silva et al. (2006) qui n’ont pas détecté une activité polysaccharidique chez les adultes de la Cératite. Par contre, ils ont démontré que chez les diptères notamment la Cératite, la digestion des carbohydrates est essentiellement réalisée par des exo-glycosidases et que dans l'intestin de l'insecte adulte l'activité enzymatique sur le sucrose a été associée à defaibles activités β-galactosidasique et α-glucosidasique.En effet, nos résultats ont montré également une faible activité β-gal chez tous les adultes avec une légère augmentation chez la souche de laboratoire non irradiée et une faible activité de l’α-glucosidase. En revanche, une importante activité di-saccharidique sur le maltose a été notée chez les adultes issus des oranges et les adultes du laboratoire irradiés. Cette activité a également été démontrée par Silva et al. (2006) chez le stade larvaire et le stade adulte.

En ce qui concerne l’activité protéolytique, nos résultats ont montré une importante activité sur l’hémoglobine. Encore une fois ceci doit être en étroite relation avec l’alimentation larvaire puisque le pH des fruits choisis ainsi que celui du milieu larvaire de la souche du laboratoire sont acides (Tanaka et al. 1969). Les pH acides font intervenir des protéinases acides principalement l’hémoglobinase qui ont été précédemment isolées chez les diptères (Terra et al. 1996). Ceci est enaccord avec les résultats de Silva et al. (2006) qui ont détecté une augmentation notable de l’activité de l’hémoglobinase et de l’azocaseinase. Cette activité est d’autant plus prononcée chez la souche de laboratoire irradiée et non irradiée.Ceci est certainement dû à une alimentation larvaire très riche en protéines (7% de levure torula). Il est cependant important de noter que l’irradiation n’a aucun effet sur l’activité des enzymes protéolytiques. En effet, la seule étude réalisée sur l’effet de l’irradiation sur les enzymes protéolytiques par San Anders et al. (2007) n’a pu déceler aucun impact de l’irradiation. Il en est de même pour les activités carboxyliques et protéolytiques.

5. Conclusion

La charge bactérienne du tube digestif n’est pas influencée par le milieu dans lequel a évolué l’insecte. En contrepartie, nous avons pu démontrer une dysbiose importante qui est également confirmée par d’autres travaux suite à l’exposition des mâles de la Cératite aux rayons gamma. Il est donc essentiel d’étudier la structure du microbiote intestinal des mâles issus de différents fruits pour pouvoir reconstituer cette flore chez les mâles de laboratoire par l’ajout de probiotiques.

Remerciements:

Nous voudrions remercier tous les techniciens qui ont contribué à la conduite de ce travail, à savoir Mme Wafa Marzouki, M. Lotfi Sellini et M. noureddine Ben Ali.

 

6. Références bibliographiques

Baker JE, Woo SM, Byrd RV (1983) Ultrastructural features of the gut of Sitophilus granarius (L.) (Coleoptera: Curculionidae) with notes on distribution of proteinases and amylases in crop and midgut. Can. J. Zool. 62 : 1251–1259.

Baruffi L, Damiani G, Guglielmino CR, Bandi C, Malcrida AR, Gasperi G (1995) Polymorphism within and between populations of Ceratitis capitata: Comparison between RAPD and multilocus enzyme electrophoresis data. Heredity 74:425-437.

Balaure DG, Gudovan D, Gudovan L (2017) Nanopesticides: A new paradigm in crop protection. New Pesticides and Soil Sensors, pp 129-192.

Behar A, Jurkevitch E, Yuval B (2008) Gut bacterial communities in the Mediterranean fruit fly (Ceratitis capitata) and their impact on host longevity. J Insect Physiol. 54: 1377–1383.

Ben Ami E, Yuval B, Jurkevitch E (2010) Manipulation of the microbiota of mass-reared Mediterranean fruit flies Ceratitis capitata (Diptera: Tephritidae) improves sterile males sexual performance. ISME J. 4:28–37.

Ben Yosef M, Jurkevich E, Yuval B (2008) Effect of bacteria on nutritional status and reproductive success of the Mediterranean fruit fly Ceratitis capitata. Physiol Entomol, 33 :145-154.

Bernfeld P, (1955) Amylase a/b. Methods Enzymol 1 : 149.

Bradford MM, (1976) A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding. Anal. Biochem. 72 :248–254.

Dyck V, Hendrichs J, Robinson A (2005) Sterile Insect Technique: principles and practice in area-wide Integrated Pest Management. Springer, IAEA, the Netherlands.

Franz G (2005) Genetic sexing strains in Mediterranean fruit fly, an example for other species amenable to large-scale-rearing for the sterile insect technique . In: Dyck VA, Hendrichs J, Robinson AS, editors. Sterile Insect Technique: Principles and Practice in Area-Wide Integrated Pest Management. Springer: IAEA, the Netherlands; . p.427–451.

Haddaoui I, Mahjoub O, Mahjoub B, Boujelben A, Giuseppa Dibella G (2016) Occurrence and distribution of PAHs, PCBs, and chlorinated pesticides in Tunisian soil irrigated with treated wastewater. Chemosphere 146:195-205.

Knipling EF (1995) Possibilities of insect control or eradication through the use of sexually sterile males. J Econ Entomol 48: 902–904.

Klassen W (2005) Area-wide integrated pest management and the sterile insect technique. In: Dyck VA, Hendrichs J, Robinson AS editors. Sterile Insect Technique: Principles and Practice in Area-Wide Integrated Pest Management. Springer, IAEA, the Netherlands. p. 40–61.

Hamden H, Msaad Guerfali M, Fadhil S, Saidi M, Chevrier C (2013) Fitness improvement of mass-reared sterile males of Ceratitis capitate (Vienna 8 strain) (Diptera: Tephritidae) after gut enrichment with probiotics. J Econ Entomol. 106: 641–647.

Liquido N J, McQuate G T, Suiter K A (2017) USDA Compendium of fruit fly host information (CoFFHI), edition 3.0. Raleigh, NC: United States Department of Agriculture, Center for Plant Health Science and Technology. https://coffhi.cphst.org/(accessed 24 October 2017).

Magaña C, Hernández-Crespo P, Ortego F, Castañera P (2007) Resistance to malathion in field populations of Ceratitis capitata, J Econ Entomol. 100 : 1836–1843.

Malacrinò A, Campolo O, Medina RF, Palmeri V (2018) Instar- and host-associated differentiation of bacterial communities in the Mediterranean fruit fly Ceratitis capitata. PLOS ONE 13(3): e0194131.

Msaad Guerfali M, Raies A, Ben Salah H, Loussaief F, Caceres C (2007) Pilot Mediterranean fruit fly Ceratitis capitata rearing facility in Tunisia: constraints and prospects. In: Vreysen MJB, Robinson AS, Hendrichs J editors. Area-wide Control of Insect Pests: From Research to Field Implementation. Springer: Dordrecht, The Netherlands. p. 535–543.

M’saad Guerfali M, Parker A, Fadhl S, Hamden H, Raies A, Chevrier C (2011) Fitness and reproductive potential of irradiated mass-reared Mediterranean fruit fly males Ceratitis capitata (Diptera: Tephritidae): lowering radiation doses. Fla Entomol 94: 1042 –1050.

Niyazi NC, Lauzon R, Shelly TE (2004) Effect of probiotic adult diets on fitness components of sterile male Mediterranean fruit flies (Diptera: Tephritidae) under laboratory and field cage conditions. J Econ Entomol 97: 1570–1580.

Ovruski SM, Schliserman P (2012) Biological control of tephritid fruit flies in Argentina: historical review, current status, and future trends for developing a parasitoid massrelease program. Insects 3 (3):870–888.

Tanaka N, Steiner LF, Ohinata K, Okamoto R (1969) Low-cost larval rearing medium for mass-production of oriental and Mediterranean fruit flies. J Econ Entomol. 62: 967–968.

Salem FB, Said OB, Aissa P, Mahmoudi E, Monperrus M, Grunberger O, Duran R (2016) Pesticides in Ichkeul Lake–Bizerta Lagoon Watershed in Tunisia: use, occurrence, and effects on bacteria and free-living marine nematodes. Environ Sci Pollut Res. 23:36-48.

San Anders V, Ortégo F, Castaniera P (2007) Effects of Gamma-Irradiation on Midgut ProteolyticActivity of the Mediterranean Fruit Fly, Ceratitiscapitata (Diptera: Tephritidae). Arch Insect Biochem. 65 :11-19.

Silva F, Alcazar A, Macedo LLP, Oliveira AS, Macedo FP., Abreu LR, Santos EA, Sales M P (2006) Digestive enzymes during development of Ceratitis capitata (Diptera : Tephritidae) and effects of SBTI on its digestive serine proteinase targets. Insect Biochem Mol Biol. 36:561–569.

Wei Ge, Yiling Lai, Guandong Wang, Huan Chen, Fang Li, Sibao Wang (2017) Insect pathogenic fungus interacts with the gut microbiota to accelerate mosquito mortality. Proceedings of the National Academy of Sciences May 2017, 201703546; DOI: 10.1073/pnas.1703546114

YuvalB, Kaspi R, Shloush S, Warburg MS (1998) Nutritional reserves regulate male participation in Mediterranean fruit fly leks. Ecoll Entomol.23: 211-215.

 

Add comment


Security code
Refresh

Copyright

This article is published under license to Journal of New Sciences. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

CC BY 4.0